Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E543913

Search information 
Request: 543913Match: SGN-E543913
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192577Clone name: TUS-65-P15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93560 [cLEX-15-A3] Trace: SGN-T117854 EST: SGN-E305368 Direction: 5' Facility: TIGR
Clone: SGN-C192577 [TUS-65-P15] Trace: SGN-T349831 EST: SGN-E548956 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543913Length: 744 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543913 [] (trimmed) GTCGCAAACCAACATTGCCTTTCGAGTTTCGCAGGCTAACCTGAAAGAACAACAGCTAACTCCAGCCCAGAGAGAGCAGTGCCGTCGAAATTTCG
CCAAATACGACACAGACAATAGCGGAACACTTGACAAGCAAGAGTTTCGTGCCTTATTAGAAGATACCTTGAACCGAAAAATCTCGGACAATCTA
TTTGCCAAATACTTTGAAATACAATTCAATGCTACAGATGCAGACTACAATGGTAGTATTGACTTTAATGAATTTGTTTCACTCTACAGCAAGAT
TTATTTGGATCCAGAGCTCCCTGTACATGGATACAGACAAGTAGAGAAAAAGGTGGTTTTGGAAACAGGAGAGAATGCACCAAAAGTGGACCGAC
AGGAATTTTCACTAAACCCAGAACAACTGGCAGAGGCTAGAACAAAATTCGAAGACACCGACAAAAATAAGAACGGAACCATTGACAAAGGAGAG
TTGCGTAGTTTGCTGTTGCAGACTGTGGGGAAAAAAATGAGCTCTACAATGGTGAACCGATATGTGGATATGCAATTTCAAATGTGGGATAAAGA
CGATAGCGGCGCAATAGATTTTGATGAATTCACTAAACTGTATGCAAAGATGTACGCTCATCCAGAAGGCGCCGAGCAACCACTCGGAATGGGAC
TTCCATTTCCTGGCATTGGACCTCGATCTTAAGAACGTAGCACTGTGGGATTGTTATTAATTATTGTTACTGTCATTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543913] SGN-U570709 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344788 [Download][View] Facility Assigned ID: TUS65P15_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0037 Quality Trim Threshold: 12.5