EST details — SGN-E543951

Search information 
Request: 543951Match: SGN-E543951
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192599Clone name: TUS-66-A13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93684 [cLEX-15-G24] Trace: SGN-T117749 EST: SGN-E305263 Direction: 5' Facility: TIGR
Clone: SGN-C192599 [TUS-66-A13] Trace: SGN-T344825 EST: SGN-E543950 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543951Length: 761 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543951 [] (trimmed) GCGATGAAATTGAATCAACTGAAGCAATTCGTTGAACAGTGCAAATCCAATCCTTCCATTCTCTCCGATCCTTCTCTTTCATTTTTCCGTGACTA
CATTGAGAATCTCGGTGCTAAACTTCCTCCGGCTGCTTACGACACCGGCGATTACAAAGAGAAGTCCCATGCGGTGGATGCGAGTGATGATGAGA
TGGATGATGATGAGAATGATGCTAATATCAAAGAGACAGCTGAAGAACAGGAGGAGCCTGAGATAATTGAATCTGATATTGAGCTTGATGAGAGT
GACACTGTGGAACCTGACTATGATGAGCCACAGAAGATGGGAGACCCTTCTGTGGAGGTGACTGAAGAAAGCCGTGATGCTTCTCAGGAGTCCAA
AGCTGAGGCCATGGAAGCAATTTCTGAAGGTAAGTTAGAAGATGCAATTGAGCATCTTACGAAGGCAGTTCTCCTCAATCCTAAATCAGCAATTA
TGTATGCTACTAGAGCTAGTGTTTATATCAAGATGAAGAAGCCAAACGCTGCCATACGAGATGCAACTGCAGCATTGGAGTTGAATCCAGATTCT
GCTAAAGGTTACAAATCTCGTGGCATTGCCAGAGCCATGCTGGGACAGTGGGAGGCAGCTGCTAAGGATCTTCATGTGGCTTCGAAGCTGGACTA
TGATGAGGAAATAAGTGCTGTGCTTAAGAAGGTTGAGCCCAATGCACATAGAATTGAAGAACACCGCANGAAATATGATAGGTTGCGCAAAGAAC
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543951] SGN-U573578 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344826 [Download][View] Facility Assigned ID: TUS66A13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5