EST details — SGN-E544154

Search information 
Request: 544154Match: SGN-E544154
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192717Clone name: TUS-66-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95302 [cLEY-11-F23] Trace: SGN-T118894 EST: SGN-E306970 Direction: 5' Facility: TIGR
Clone: SGN-C192717 [TUS-66-F11] Trace: SGN-T345028 EST: SGN-E544153 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544154Length: 732 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544154 [] (trimmed) GAGGAAAATATGGAAAGAGGTATGCAGATGTGGGAGGAGGCAGAGGAACAGCGTCTGAACGAACTATCAAGTACCAACAAATTGCAGAAGATGAA
GTCAGAGAATTTGTTTAAAGGAATATCTGCAGATGAAGCTTCTGAGCAAGCTGCAAACATGATGTCTCAGATAAATTTACTATGGGGTACCATGC
TATACGAACGATCACTTATGGAGTTCAAACTTGGGCTTCCACTCTGGCAAGAATCTTTGGAGGTTGCTGTTGAAAAATTTGAATTGGCCGGAGCT
TCTCCAACAGATATTGCTGTTATGATAAAGAATCATTGTTCCAACAGTACAGCGACAGAAGGGCTGGGATTCAATATTGACGAGATAGTGCAGGC
ATGGAATGAGATGTATGAAGCAAAACGGTGGGAAAGAGGCGTCCCTTCTTTCAGGTTGGAACCGTTGCTTAGGCGGCGAGTTTCCAAGCTGTATC
ATGCCCTTGAATTAGCATGAGTTCTGGTTATGGTGTCAGAGGAATCAAGAAAGAAACTCACTATTACTGTTGTTGTTGCACTCAGTCTACGCTAT
GCTCGCTGGGAAGGGATTGTTTGTGCATCAGCTGTTAATACAGGTTTTGGAATTTGGACCTTGTGGCACTATCATACTAAGGATTGTATTACCTG
TTTTCGTTCCATCGCTTTTTACAGTATCACAAAGGAATTAAAGAAAAGAGAAGTTTTTATCTCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544154] SGN-U569770 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345029 [Download][View] Facility Assigned ID: TUS66F11_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5