EST details — SGN-E544242

Search information 
Request: 544242Match: SGN-E544242
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192769Clone name: TUS-66-H15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95526 [cLEY-12-E18] Trace: SGN-T119116 EST: SGN-E307407 Direction: 5' Facility: TIGR
Clone: SGN-C192769 [TUS-66-H15] Trace: SGN-T345118 EST: SGN-E544243 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544242Length: 816 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544242 [] (trimmed) GCGAAAATCAGCTGAAGGAGAGGTACATTCGACACAATATTTACTCCATGGACTTGAGCTCCGCTTACAATACATTCTTTTCAAGTGGGAGTTCA
GCATTTTCAAAGATCACAACTTAAGTTAATTGTGCACTCCTTCCCTTTTGCCAGTTCATCCAACGACAAAACGGGAGGTGGCCAACAAAATATAT
TCATAGCTGGAGAGAAAACGAAAAGAATGATAGAAACAGATTACTTGTCAATCCAATAATACTAAGTTTTGCCGTTTGGTTTTGGTGAGTTCTGA
GGAAACTGTTGATGGTATGGAGAAGCATGAGAACCATTTGGGATTGAAAGACTTCTAGGATGTTGTTGTCCATTCCTCGAGAATGATCCCTGTGT
CCTAACGCCATTTTTGGTACTTGGACTTGATCCAACTCGGTCTGCTTGCATTGTCTGGAAATAGTAGGATGAGCTGGCCATGTCTTTAAGATTTG
GTAATGGCTTCAAGGCTTCTACCACTTCACTCATCATAGGCCTAACTTTGGGATCACGACTAAGGCAACGAGCAGCCAACTGTGCAGCTTTCTGA
GCACCTTTTATTGAAAAATGACCTTCAAGTCTAGGGTCTACCAATCTGTAAAACCTTCTTCTTTCACCAAGATGAGGCCGTGCCCATTCAACAAG
GTTGTGTTCCCCATTTGGTCGGTTCTTGTCCATCGATCTCCTACCTGTTATCATTTCAAGTAGAACTACCCCAAAACTGTAGACGTCACTCTTTG
ACGTTAGATGCCCTGTCATCACATACTCAGGGGCTGCATAACCATACGTTCCCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544242] SGN-U584937 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345117 [Download][View] Facility Assigned ID: TUS66H15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0016 Quality Trim Threshold: 20.5