Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E544321

Search information 
Request: 544321Match: SGN-E544321
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192815Clone name: TUS-66-J13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95776 [cLEY-13-D18] Trace: SGN-T119419 EST: SGN-E306241 Direction: 5' Facility: TIGR
Clone: SGN-C192815 [TUS-66-J13] Trace: SGN-T345197 EST: SGN-E544322 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544321Length: 836 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544321 [] (trimmed) GCAAAGATATCTCCAGTTTTTCAAGCCATCAACCAGAAAACATAAAACTAAGACCTTGTTTAGACATTCTGTAATTAGAAACTAGCAGTACCTGA
TCCTCCTTCGGAATTTTTCATGAGAACGCGCTGCTTCACGTATTCTCATGACTATAGAATAAATCTTATATCCCACAATCGCGATACCCAAAGTG
AGAGAAAACAGGGAGAGGAAATCATTGATTTAATGACAATTTACAACTGATATATAAAGCTTGAGCTATTGTCTTACGTGAGCCCTAGCTCGAAC
AGCACCCAAACTTTTTCCAAGCAGATCCTTCATCTTTGATATTAATCGTCTGTCCTTTAGGTGGTGCGGTTGAAGTAGCACCTTCGTCCCCTGCC
TCGACTGCTTTCTTACTGACGATCCGGTATATCTGCGTGAGAGCTTCAGTAAACGCATTTTCAACGTTGGTCGCTTCTAATGCAGAAGTTTCCAT
GAAGTATAGGGCTTCCCTCTCTGCCAAAGATTTAGCCTCTTCAGTTGAAACAGCCACGAGATGTCGGAGATCTGATTTGTTGCCTAGGAGCATGA
CTACAATGTTAGGGTCAGTATGGTCTCTCAATTCCTTCAACCACCTGTTGACGTTTTCAAAGGTAACATGTCGAGTAACATCATATACGAGCAAA
GCACCGACAGCTCCCCGATAATAAGCACTCGTAATGGCACGATACCTGGTATGAAGAAGAAAAACTGAAGCAATAGTACAACAACTTAAAGGAAC
AAGGATGCATCCCAATACATTCCCTTTCTATCAACAGTAACAATAAGTTGCATATAACACCATTCTCCATCAGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544321] SGN-U564990 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345196 [Download][View] Facility Assigned ID: TUS66J13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0004 Quality Trim Threshold: 20.5