EST details — SGN-E544369

Search information 
Request: 544369Match: SGN-E544369
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192843Clone name: TUS-66-K17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95923 [cLEY-13-N18] Trace: SGN-T119438 EST: SGN-E306260 Direction: 5' Facility: TIGR
Clone: SGN-C192843 [TUS-66-K17] Trace: SGN-T345245 EST: SGN-E544370 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544369Length: 436 bp (969 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544369 [] (trimmed) CTTTTTTACTAATCAAATACTTACATATTAAAGTTGGAGGATAGATTATCAATTACTACAATTTATTTACCATTCACGAAACTTTGCTTCAAATT
AAAACAAAATGATTAACACAAACGGTAGCACACAAAATATGCTTCTCAATCAAACCTTTTGATCATTGGGAGACCCGACCCGACATTCCATCACC
TCCGGATCCCTGCATTTCTTCGCTAACTGGACCTCCGTAACCCGGAACAACTCCTGAATTCCTAACTGCATAGTAATTCATTCCTTCAGTAACAA
CTCTTAATTCATTCGGGTCAACACTCATTACCGGCCTCAATCCACTATATACTTGGCCCATACTTGAACCGGGCGGATACCCGACGGGTAATTGA
TTCTTAGGAACTGTCAAAGGATCAACATATGGAGCCCTTAATGCAATGGGTTGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544369] SGN-U585430 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345244 [Download][View] Facility Assigned ID: TUS66K17_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0037 Quality Trim Threshold: 20.5