Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E544374

Search information 
Request: 544374Match: SGN-E544374
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192845Clone name: TUS-66-K19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95936 [cLEY-13-O15] Trace: SGN-T119360 EST: SGN-E306182 Direction: 5' Facility: TIGR
Clone: SGN-C192845 [TUS-66-K19] Trace: SGN-T345248 EST: SGN-E544373 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544374Length: 788 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544374 [] (trimmed) GAGGACTAGGTCTATACATGGAGAACAAGAACAAAGCTGAATATTATAGTCCTGATGATGAAGATCGCGATATCGATAATCAAGAAAATATTATC
CATCAGGGAGGTGCTGTTAATGTTATGGTAAAGAGAGAAAGATCCCCACCGGAACACAACTCAATGGCTTCTTCATCTACTCACAAAGAACAGGA
CGATCAGCTAGCATCAGCCAAAGATGAAATGCGAGAAGTAATGGAAGAAAATCAGAGGCTTCGAATGCACTTAGATCGAATGATGAAGGAATATC
GAAATCTCCAGAACCAATTTCACGATATCGTTCAAAAAGAAACTGATCAAAAATCAAGCAGTACTACTGTCAACACTAGTACAACACATCATGAT
CATGAATCTGATCAAGAAGCTGATCAACTTGTGTCCCTCAGCTTAGGAAGAACTACTAGCGATATGAAGAAAGATGATTTATCTAAAATCTTAAA
GAAAGATAAAGTTCATGACGATGAAGGAGTTAGTAATAATAATAAAAGCCTTGATTTAGGATTGGATTGCAAGTTCGAAACAACGCCAACTGAAT
GTTCACCAGTGAATTATAGTCCGGAGAATAGCTTAGATGATATTCAAGCTAATAAGGATGAAAATGAAGAGACGTCGAATAAAAATCTCAAGACG
ATGAGAAATAATGGAGATGGAGATGATGTTTCGCAACAAAACCCTACTAAAAGAGCTAGGGTTTCTGTTAGAGTCAGATGTGATGCCCCTACGAT
GAATGATGGATGCCAATGGAGAAATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544374] SGN-U571280 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345249 [Download][View] Facility Assigned ID: TUS66K19_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5