Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E544768

Search information 
Request: 544768Match: SGN-E544768
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193075Clone name: TUS-67-E9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97098 [cLEY-19-L9] Trace: SGN-T120603 EST: SGN-E306756 Direction: 5' Facility: TIGR
Clone: SGN-C193075 [TUS-67-E9] Trace: SGN-T345644 EST: SGN-E544769 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544768Length: 830 bp (891 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544768 [] (trimmed) CGATTTAAGCCTTCCGAGGCTTTATTCGACAGTCAGACATGTAGCCGCTGGAGCTAATTGCGCTGTTCAACAGAGGCGCCCGAGAGGCCCGCCTC
CTTCACTGTAGCCTTGGGATCAGAAAGAGCCTTAGGCGGAAACCCGCTCCACAACGCGAAGGGCGCGTTGGCTTTGGCAAGGAACATCACATGTC
GATACACATCCATTACAGTGTGGTCAAGATTGAACTCTTGGCGGACTCTTGTACGGTTGGCCAAAACCAATTGAACCGTTGTCTTGGGCTTTGAA
CCATCTACTTCAATTTGTTTCGGAGTTGCCCCAGAAAAGTTTTGTGCAGAAGAGCCTCCTGATGAGCTTCCCAGACTCAGGCCTTGAGATTTGGC
AAAGTCAAACTTTGGCTTTGGTACTTGATATTCTTCAGATGATTTGTCGACCAAATTCACAGCCACTTCTCGAGCATTGGGAAAGTTTGATCGTA
CTTCGCCTTCTAACTCAGCGGGCACCTCGCCGTTGCGAAGGTCTTCGAGGAATTGTTTGTTTTCTGGTGAGCTCAAGTCGCGAAAAGGAGCCTCT
CCAATTTGAAATCCATTCTTATAGATTGTGATGAGAGCGATATTCCGGTCGAGGGCGCCGCCAGAAGGAGCTTCTCTGGAAAGACTTTTCGCTTT
GGCAATGACATCTTGGGTGGTGTCGCCAGTTGGAATTGGCTTCCATACCGCTGTTGAGCTTGATTGCTTCGTCGAGTTGGAGAATTCCTCAACAT
CTTTCTTCTCGTTCTTGGTTACTTTGCCGAGACCATGAATGTTTGACATCTTGAAATGCTGCAGAAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544768] SGN-U568170 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345643 [Download][View] Facility Assigned ID: TUS67E09_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0025 Quality Trim Threshold: 20.5