EST details — SGN-E544770

Search information 
Request: 544770Match: SGN-E544770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193076Clone name: TUS-67-E10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97101 [cLEY-19-M14] Trace: SGN-T120482 EST: SGN-E306635 Direction: 5' Facility: TIGR
Clone: SGN-C193076 [TUS-67-E10] Trace: SGN-T349972 EST: SGN-E549097 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544770Length: 762 bp (875 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E544770 [] (trimmed) AAAAAATAGAAATGGTCAGATTGAAGGAAGAAATGGAAAGTGAAACTAAATGAAGGAAGAGGTACAAATAACAATGATTGAAACAAGGCACCATT
AAAACAACATATGATGGATTCACATCCTCTTATTTTCTTAGCTACCGTATCAAAAGATAAGACATACATAATTAGATTTGATATATTTCCTCTAA
ATATTGTTATTGGAGATTCTCACATCCCTTAGAATTTTGGCAGCATCCTCTGGGAAAACAGGATTTATGTAACATCCCGTTGCTATCTCAAATCC
ACCAACTCCACTCAAATGGGGAGCGATTTGTAAAAACCAGTGTGTAGAAGGTGCATTTGAGGGGTCATCCTGATATGGGGAAGAATGAATCAGAA
GATTGAATGGCGGATTGTTCAACTGCAAAGACATCTTCAAAAGCATGAGTTTCAACAACCCTCCAAGATCAACTGCCTTCTCACTATCTATTTCA
TGAAAATGAGAAGAGTGATCACGAGGAATTATCCAAATCTCAAAAGCAAAAGTTGCAGCGAAGGGAACCAGTGATATGAAATGGGCTGATTCAGC
AATTAACAACTCATTTGGTTGAATATCACACAGGCTGCATTTTCCAGTCTGCTTGTAGTATTCCATCATACTGTCGAGACGGGCAGAAACTGTTG
GAGGAACAATGGGAAGAGCAATCATCTGGCTGTGAGAATGGCTCATCGAAGCACCAGCAGAGGCTCCATGGTTTTTGAACACCTGAACATACTTG
AT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544770] SGN-U569568 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345645 [Download][View] Facility Assigned ID: TUS67E10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5