EST details — SGN-E545066

Search information 
Request: 545066Match: SGN-E545066
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193248Clone name: TUS-67-L14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98053 [cLEY-25-O11] Trace: SGN-T121618 EST: SGN-E308355 Direction: 5' Facility: TIGR
Clone: SGN-C193248 [TUS-67-L14] Trace: SGN-T345940 EST: SGN-E545065 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545066Length: 704 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545066 [] (trimmed) GTCCAACAATTGATGTTTCTCCATTTTTTAAATCAGATGAAAATGAAGGAGCGAAAAAGCAGGCTATTGAGCAAATTAGAGAAGCTTGTGTTAGC
TATGGTTTCTTTCAAATTGTGAATCACGGAATTCCTTCTGACTTGTTGAGCAGAACCATCGATATGTATAAGACTTTCTTTGGCTGTTCCGATGA
AGAAAAACTGTGTTTACCTGATAATTATTTAAAAAGCACGCCGAATTCAGCTGAGACTTTTGAGCACTTGTGGTTTCGTTTTCCATTCTCTGGCT
TCAATAACTGCCGCAGCATTACACCTCATTTCAAGAAAGTATTGGAGGAGATTGTTTCCCATTTCACAAAATTAGGAGTTGTGTTGGAAGGGATC
ATAAGTGAGTGTCTTGGACTCCCTCCTGACTTCCTCTCAAACTACAGAAATGGTCGTTCTCGGGACTCGTTGATGGGGCTGCACTACTTTCCAGC
GACAGAAGATGACAACACAGGAAAACCTGCACATGAAGATCCTGGCTGCTTCACTATTCTCTACCAGGATGAAATCGGAGGCCTTCAAGTGCACA
AAGATGACCACTGGATACCCATACCGCCTTCCAAAGACAAACTAGTTGTTAACATTGGTGATGTCATTCAGGTGCTAAGCAACAATAAATTCAAG
AGTGCAACTCACAAAGTAGTGAGAACAATTGAAACAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545066] SGN-U574083 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345941 [Download][View] Facility Assigned ID: TUS67L14_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5