EST details — SGN-E545069

Search information 
Request: 545069Match: SGN-E545069
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193250Clone name: TUS-67-L16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98066 [cLEY-25-P8] Trace: SGN-T121703 EST: SGN-E308440 Direction: 5' Facility: TIGR
Clone: SGN-C193250 [TUS-67-L16] Trace: SGN-T350021 EST: SGN-E549146 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545069Length: 431 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545069 [] (trimmed) GAAAGCAAGAAGGGAGCTGATGATGGTTTGACTCCTGAGCAGCGCCGTGAAAGGGATGCGAAAGCTCTGCAAGAGAAGGCTGCAAAGAAAGCAGC
AAAAGAGGCTGCCGGAGGTAGCAATGCTGGAACTAAGGATACCAAGAAATAGAAAGCTAGGTGTTGTGTACTTCATTGCAGTCAGTAATTTGTCA
TTCCCCTTTGTTTGTCATGTTATTCACTGTTTAAATCTTGTGATGCACTACAACTTAATACGTCTGAATTGTCAATCCATTCGGTTTTGAACTAT
CTCGTCTTTCTTTTGATATGATAAACTCCACCCCCAAATCACCTGTGTTTCAGTTGTTGCAATACTTATGTCAATTGTGCTGATATAGAGTTGTA
ATGCACCTTGTGCGTAGAATTTTATGCAATGGCAAAGGCAGGGTAAATGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545069] SGN-U578731 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345944 [Download][View] Facility Assigned ID: TUS67L16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5