EST details — SGN-E545094
| Search information |
| Request: 545094 | Match: SGN-E545094 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C193265 | Clone name: TUS-67-M7 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C98181 [cLEY-26-H23] | Trace: SGN-T121556 | EST: SGN-E309738 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C193265 [TUS-67-M7] | Trace: SGN-T345970 | EST: SGN-E545095 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E545094 | Length: 39 bp (903 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E545094 [] (trimmed - flagged)
GCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGG
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T345969 [Download][View] | Facility Assigned ID: TUS67M07_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.931 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |
Working
