EST details — SGN-E545094

Search information 
Request: 545094Match: SGN-E545094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193265Clone name: TUS-67-M7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98181 [cLEY-26-H23] Trace: SGN-T121556 EST: SGN-E309738 Direction: 5' Facility: TIGR
Clone: SGN-C193265 [TUS-67-M7] Trace: SGN-T345970 EST: SGN-E545095 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545094Length: 39 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545094 [] (trimmed - flagged) GCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T345969 [Download][View] Facility Assigned ID: TUS67M07_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.931 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5