EST details — SGN-E545101

Search information 
Request: 545101Match: SGN-E545101
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193269Clone name: TUS-67-M11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98216 [cLEY-26-J9] Trace: SGN-T121560 EST: SGN-E309742 Direction: 5' Facility: TIGR
Clone: SGN-C193269 [TUS-67-M11] Trace: SGN-T345977 EST: SGN-E545102 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545101Length: 53 bp (939 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545101 [] (trimmed - flagged) GCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T345976 [Download][View] Facility Assigned ID: TUS67M11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.936 Expected Error Rate: 0.0209 Quality Trim Threshold: 14.5