EST details — SGN-E545102
Search information |
Request: 545102 | Match: SGN-E545102 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C193269 | Clone name: TUS-67-M11 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C98216 [cLEY-26-J9] | Trace: SGN-T121560 | EST: SGN-E309742 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E545102 | Length: 230 bp (990 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E545102 [] (trimmed)
GAAGACATATAACTTCTCAATGGTCACTTTACTGTCAAAACCGAGCATATTCAGTTTGTGTGAAGGCAAATGTACATAATGGTGGCACAGGTCCC
TAATCTAGTAGAGTTATCGTTTTCCCATTTCTGCATCTCTCTTAGACCTTTGTAATAAGTTAGTATATGATAAATTTATGTAAAAGATAATCTTT
GGAGGGTCCTAGTATTATTAATTTAACCTGGCATTGCTTC
TAATCTAGTAGAGTTATCGTTTTCCCATTTCTGCATCTCTCTTAGACCTTTGTAATAAGTTAGTATATGATAAATTTATGTAAAAGATAATCTTT
GGAGGGTCCTAGTATTATTAATTTAACCTGGCATTGCTTC
Unigenes |
Current Unigene builds | |||||
[SGN-E545102] | SGN-U580758 | Tomato 200607 | Build 2 | 12 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T345977 [Download][View] | Facility Assigned ID: TUS67M11_Q1 |
Submitter: Koni | Sequencing Facility: INRA (MWG) |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.940 | Expected Error Rate: 0.0017 | Quality Trim Threshold: 12.5 |