EST details — SGN-E545202

Search information 
Request: 545202Match: SGN-E545202
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193327Clone name: TUS-67-O21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100420 [cLEZ-8-C24] Trace: SGN-T122026 EST: SGN-E310060 Direction: 5' Facility: TIGR
Clone: SGN-C193327 [TUS-67-O21] Trace: SGN-T346076 EST: SGN-E545201 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545202Length: 686 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545202 [] (trimmed) TTTGAACAAATATTATTTAGAGAAATAAAGTGAGAATTATGAAAATGAATATAGTTTTTATAGCCTCATTAATTTTGGTGTTTTCTAATTTTATT
GAAGCCTCAGATGGAATGGATGTTATGCATATTTCTGGCAAAGTTCTTTGCCAAGATTGTACTCAAGGATGGAATGAATGGGTTGATGGTGCCAA
AGCCATCAAAGGTAGCATCGTATCTCTGACGTGCCTGGACGAGAGAAGAAGAGTGATGTATTACGGAAGTGACCTCACAGATGAAGCTGGAATTT
TCGATTTGATTGTTAACCAAACTTGTCATGGCAAAACAATTAAGCCACAAAATTGCTTTGTGAGATTGGTTTCTTCACCTGATCCTGTTTGTAAT
ATTGCCACCGACTTCGCCGGAGGAAAATCCGGTGTAAAGCTCCACCGTCCGACGGTGGTTTACCGGGACTTGCTCAAATATGTGCTTAGCCCTTT
CTACTACACAACTCCCATGTGTGATGAACCTAATATTAATGATGATGATAATTTGGAGACTAATGATGATAAAAATCAAAACAATTATTAAATTA
AGTTCTTATTTTTAATTTTTTCTTCTTCTAATGTTTGTGTTTAATTTCCCATTTTGTAAATGGAAAATGACAATTTATCTATGTTGGATGAGTTG
ATGATTTTATTTTGTACTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545202] SGN-U582347 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346077 [Download][View] Facility Assigned ID: TUS67O21_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5