EST details — SGN-E545289

Search information 
Request: 545289Match: SGN-E545289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193378Clone name: TUS-68-A24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545289Length: 421 bp (992 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E545289 [] (trimmed) GCACGAGGGCAAAATCCCATGAAATTGAGCACCCAATTAAGGCATTTGGATGGGCAGCTAGAGACACTTCTGGTGTTCTTTCTCCTTTCAACTTC
TCAAGAAGGGCTACTGGTGAGAATGATGTACAATTCAAAGTGTTGTATTGTGGAATTTGTCACACAGATCTACATATGCTCAAGAATGAATGGGA
TAATTCCAAGTACCCTATTGTGCCAGGGCACGAGATCGTGGGCGTAGTTAACCGAGGTCGGTAGCAAGGTAAAAAAAGTGAAGGTGGGGGACAAT
GTAGGTGTTGGAGTCATAGCAGGATCATGTCGAAAATGTGATAGTTGTACTAGTGACCTCGAACAATATTGTTCTAGCAGTATTAACACGTATAG
TACAACTTACTATGACGGAACCACCACGTACGGAGGCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545289] SGN-U578688 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346164 [Download][View] Facility Assigned ID: TUS68A24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5