EST details — SGN-E545472

Search information 
Request: 545472Match: SGN-E545472
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193485Clone name: TUS-68-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99090 [cLEZ-15-O13] Trace: SGN-T122928 EST: SGN-E310713 Direction: 5' Facility: TIGR
Clone: SGN-C193485 [TUS-68-F11] Trace: SGN-T346348 EST: SGN-E545473 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545472Length: 565 bp (890 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545472 [] (trimmed) GATCAAACAAACCAAATTAAATATAGGAACTTATAAATACTAGGGGCTTGGACATAACAAGCATTATTCAGTAGACAGATTATATTAGTCCCGAA
ACAGGGAAATTGAATGTTATATAATAGCACTGGATAAGCCAAAAGATCCCCAATGGTCAAGTGAAGTTTTCAATTAGCGCTTCTTATTGCCTGGT
GCAACTTCCCAGGATTGGAAAAAATGGTTCACTATGTCCTCTACGCCAACCCCATGGTTCACCTGAGCAAAAACAAAAGGGCCCCCATCCCCCAT
CTGAAGTGCATCACGCTCCATGACGGACAAATCTGCTCCCACAGCTGGGGCCAAGTCGGTCTTATTTATCACAAGGAGATCTGCTTGGGTAATTC
CGGGACCTCCTTTTCGAGGAATTTTGTCACCCGCAGATACATCTATTATGTAGATTATGTAGTCAGCAAGTTCCCTACTGAAGTTGGCAGCTAGG
TTGTCTCCACCAGATTCACAGAGTAGTATATCTGCTTTGTACAAATTAGAAAGCTCCTCAAGAGGTCCAAAGGTAATGCTTATATCTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545472] SGN-U567848 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346347 [Download][View] Facility Assigned ID: TUS68F11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5