EST details — SGN-E545562
| Search information |
| Request: 545562 | Match: SGN-E545562 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C193537 | Clone name: TUS-68-H15 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C99476 [cLEZ-17-L3] | Trace: SGN-T123354 | EST: SGN-E310929 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C193537 [TUS-68-H15] | Trace: SGN-T346436 | EST: SGN-E545561 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E545562 | Length: 141 bp (915 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E545562 [] (trimmed)
GTGGAAACTTACTCCTCTGTTCCAATGGAGAAAACACCAAAATTATAAGAAAATCAATCTTCATTTTCCTTCAGAACTATCAGTTCTTCACAACA
ACAACAGCTTTTTTCGCTTTTCCATTTGCTGCTTCAGTTCTTTTTC
ACAACAGCTTTTTTCGCTTTTCCATTTGCTGCTTCAGTTCTTTTTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E545562] | SGN-U576065 | Tomato 200607 | Build 2 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T346437 [Download][View] | Facility Assigned ID: TUS68H15_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.884 | Expected Error Rate: 0.0058 | Quality Trim Threshold: 14.5 |
Working
