Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E545568

Search information 
Request: 545568Match: SGN-E545568
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193541Clone name: TUS-68-H19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99486 [cLEZ-17-M3] Trace: SGN-T123431 EST: SGN-E311006 Direction: 5' Facility: TIGR
Clone: SGN-C193541 [TUS-68-H19] Trace: SGN-T346444 EST: SGN-E545569 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545568Length: 488 bp (857 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545568 [] (trimmed) GCTAAAAATAAATATGTCTCCATAAAAAATAGTTCCTCGTACCTGATGTTTACATCGAATCAAACAATTTATCGTTTAAGAGTAATAAAACTTAA
AAGTGAGAATACATATGCTCAATCAGAGTTAAGAGAGATTTATACAATTCACTGTGTTACTGAATTGAATGAATACTGAAAAATCTCTTAATCTT
GAGCTAACAATAACAAAATGTATAACCAGTTAAGACATGGTTCATCTTGAGCAACAACTGCTCCAAGATCGTTTCGATCCTTCTCCGTCGTCTTT
TACAAGGTTTACCCTGTTAATAGATAACTCTGCCTTGTAGGAATCCGAATTCAAGACCTTTCGACTGACATTGCTATAGATTTCACGGATAACAA
TCTCGAAAGCCTTATTAACGTTTGTAGAATCCAACGCGGATGTCTCCATGAAGAACAATCCTTCTGCTTCTGCAAGCTTCGCGCCTTCTTCAATA
CTAACGTCTCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545568] SGN-U564988 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346443 [Download][View] Facility Assigned ID: TUS68H19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5