EST details — SGN-E545653

Search information 
Request: 545653Match: SGN-E545653
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193590Clone name: TUS-68-J20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99731 [cLEZ-19-A10] Trace: SGN-T123832 EST: SGN-E310631 Direction: 5' Facility: TIGR
Clone: SGN-C193590 [TUS-68-J20] Trace: SGN-T350117 EST: SGN-E549242 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545653Length: 650 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545653 [] (trimmed) GGCAACCACCTAACATTTGCTTCGTACAAAAAAAATTATGGCTGAAACTCAAGAAACAGTTTCCAAATCAGTACAAGAACTAGCAAATACCAATC
AAGTTCCAGAAAAGTATATTTATGCACAAGGATCAATCAATACCTATCCTCTTTTGTTCGATGTGCCACAAGTTGATCTTAGCCTTCTCACATCC
CCTAACAGACAACAACAGCTCAACAAACTTCAATCAGGTCTCAAGTCTTGTGGCTGTATCCAGGTCATAAATCATGGAATGGAAGATTCATTTCT
TGACAAAGTGCGTGAAATAAGCAAAAAGTTCTTTGCTCTTCCAACTGAAGAGAAGCTTAAATATGCAAGAACAGTTAATCAAATTGAAGGATACG
GAAATGATAAAGTTCTTACAGATAAGCAAAGGCTTGATTGGTCCGATAGACTGTGTCTAAATGTGTTCCCTGAAGATATAAGAGAACTCCGATTC
TGGCCACAAAAACCTGAATGTTTTAGGGAAGTTTTTGGAGAATATATGAAGAATATGAAGTTGTTGAGTGAGTCCCTCCTAAAGGCCATGGCAGC
GTCATTGAACGTGGAGGAGAATTGCTTTCTGGACCAGTGTGGAGAACGTGGGATGACTACTGCAAGATTCAACTTCTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545653] SGN-U563057 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346528 [Download][View] Facility Assigned ID: TUS68J20_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5