EST details — SGN-E545874

Search information 
Request: 545874Match: SGN-E545874
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193719Clone name: TUS-68-P5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C103267 [cLHT-7-I3] Trace: SGN-T170977 EST: SGN-E356100 Direction: 5' Facility: TIGR
Clone: SGN-C193719 [TUS-68-P5] Trace: SGN-T346750 EST: SGN-E545875 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545874Length: 776 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545874 [] (trimmed) CAGCTCAACAAAAATTTATTACGGGCAGCAAAAAAAATTCAGTTATGAAAAGCAAATGCATGTACAAGATCTCTACAAAAAGTCTAAATAAATCC
CACTCAAACGCATATCCTATCCCCATAACATCAAGAATATAAATAACTGCAACATTGTTCTATTTAATGTCTCATCTCACTCTAACCAGACCAAC
ACGTGAAAATAAATACTAGTCAATTAGCATTTCTTTCATGTTCACCCCAAGCAAATGGGGCAGCGGGGCAATGCTAGCATTTAAGGACGATCACA
ATCTTCCTGCTCCCACATCATAATGCATGGCTGGTCCAGGTGTATGAAATGATCCCAACATGAGGAGAAATATTAGTTCTTCAACTAATGTTACA
AGGAAAATCAGGTAAGCTCAGCAATCAATGATGTCAATTAACACTAACAGCAGATTTCTTCCATGGAAGCTTTTGCTCATTGGATGAACCATCCA
TAGTTGCAAGTGGCAACAAGTCCCAACTTCTTCTGGAATCGCCACTCAGTAGAAGACCACAAATGATTGAACATACAGGAACCCTTTATGCATTT
TGCTGGACTTGTCGGTGTACTTGCAGAATCCAATCCTGGTAACCAATAGAACCACCAACTGGATCCTCAATCAGATTTGCAAGCAAGAAGAAGCC
TTCTCTAGGCTGTTCACCTTGCCTCACAAGATGGCATAACTGATAATATGATCTATCACTCTCCCTCTGTCTTTTAAGCAAACCCATCAGTTCTC
TTGACATTTCATTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545874] SGN-U571604 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346749 [Download][View] Facility Assigned ID: TUS68P05_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5