EST details — SGN-E545880

Search information 
Request: 545880Match: SGN-E545880
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193722Clone name: TUS-68-P8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C103284 [cLHT-7-M23] Trace: SGN-T170986 EST: SGN-E356109 Direction: 5' Facility: TIGR
Clone: SGN-C193722 [TUS-68-P8] Trace: SGN-T346754 EST: SGN-E545879 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545880Length: 766 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545880 [] (trimmed) GAAGAGAATAATAGTATGCTATTATTAGAAATGTTCTATAGTAACAACAATTTTGATACAATAATTTTTGAAAACTATATTGGATTTGAATCAGA
TATCGGATCAACCTATATATATCTTATGATCGAAACCAAGAATGCTATAGTAGCCATGATCGAAAAGGAAAATTCTACGCGATTTTCCCTTTCAC
GTGCTTGCTCCAACAATTATCTACCGGCTACTACAAATACCTTCTTCCACTAGAGAAGTCATCGTCAATTTTGACTCCATGTAACTCGAAATCAA
GGACCCTAATTCAATTTACCTTAGGTTTGTTGGGATGGACAATATATTTACTTGTAGGGAGCAAATAATATCGATGAATTATGGCCACCAAATCC
AAATGAATTCGATATTGCCACCTTAATATCCAATCTTTCTTTTTTCGAACCCACAAGTACATTTGTATCCACACCCTCATCTGGGGTATCAAGAT
TTATATTCGGATGAACCCATCCAGTTCGTATTGCCTGAATAGTTGCTACAGCTTCAACAGCACCAGCAGCTCCTAGCAGGTGACCAATCATAGAC
TTCGTGGAGTTAATTCGTAACTCTGGGTTCTGGCCAAAACAATGTACAATCGCGTGGTACTCTTTGAGATCCCCTGCTGGTGTGGAAGTGCCATG
CGCATTAATGTAGTTCACATCTTCCTTGGATACACCAGACTGAGCTAATGCCTTTTCTATGCATAAGATTACACCAGCTCCTTCAGGATGAGGCT
CAGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545880] SGN-U582703 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346755 [Download][View] Facility Assigned ID: TUS68P08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5