Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E545943

Search information 
Request: 545943Match: SGN-E545943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193759Clone name: TUS-69-A21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100972 [cLHT-11-J1] Trace: SGN-T171400 EST: SGN-E359198 Direction: 5' Facility: TIGR
Clone: SGN-C193759 [TUS-69-A21] Trace: SGN-T346819 EST: SGN-E545944 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545943Length: 683 bp (919 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545943 [] (trimmed) GGTCACAAAAGAGCAGAGATGCATATGTATACTAGAATGTCGGTCACTATTTATATACATTGGCTTATGCGAAAAGCAGTTTTAAATAATCTCCC
ACAGAAAATATTGACGATAACAACATAACTATATGTAAGCAAAAATAAGAAATTAATTATCTATGGAAGACGCGAGATACTGATCACAAGTGCCA
TAGTAATAGTTGCTTCCTCACCTTGGATCGAATTCAACCAACCTGAAAAACATATTTCATCCACTAGAATGTGGTGTGGAGCTGTCAACTCATTT
GTTAGCGGCAACTGAATCCGGAGAAGAAAGGGAGTCCTTTAGGAGCCCAACATCATCTACCACAATATCCAGTACCTCAGCATTGAGTGCTTTCG
ACTCTCCATTCTGGATGCCTCTCAATGTCTCCAGCACTTCTTGCATTGAAGGACTCAGATCTCTCTCTTGTTGCAGACATCGGAAAGCTAACTCT
GCGACTAATGTAGTCATCCTCCTCACGGAGCTGTTTGTTGAGAATCCAAGAGTTGGATCAACTAATTCATGAATTGAATGACCTTGGATCTTGTT
GACAGCCATATTAGACAAATTAATATCATGGCGGTGCCTGCTGGTATCCACAGCTTCTAATGATGAGATCAGCTCTACCAAGACCACCCCAAAAC
TATAGACATCACTCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545943] SGN-U569715 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346818 [Download][View] Facility Assigned ID: TUS69A21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0135 Quality Trim Threshold: 14.5