Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E545981

Search information 
Request: 545981Match: SGN-E545981
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193781Clone name: TUS-69-B19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C101040 [cLHT-11-N10] Trace: SGN-T171448 EST: SGN-E359246 Direction: 5' Facility: TIGR
Clone: SGN-C193781 [TUS-69-B19] Trace: SGN-T350171 EST: SGN-E549296 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545981Length: 768 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E545981 [] (trimmed) GATTTTTGATTTCTTATCTACCAACTTAATTAGTTTTGAACATTTTTAGTGCAGAAATGGGTTACGTAAAACTTGTTTTTTTAATGCTATTTTCC
TTACTCTGTCAACTTGCTTTCTGCTCGTCCTCATCTCATTTGTGCCCCAAAGATCAAGCTCTTGCTCTTCTACAATTCAAGCAAATGTTTAAAAT
AAGTCGTTATGTTTCCGGTAACTGTTTCGACGTAAAAGGCCAACCGATTCAGTCATATCCGCAAACTCTTTCGTGGAACAAGAGCACAGATTGTT
GCTCTTGGGATGGAGTTTATTGTGACGAGACGACTGGAAAAGTGATTGAGCTTAACCTCACTTGCAGCAAACTTCAAGGCAAATTTCACTCAAAC
AGTAGTGTCTTTCAACTCTCCAATCTCAAAAGGCTTGATTTGTCTAATAATAATTTCTCTGGATCGTACATTTCGCCTAAATTTGGTGAGTTTTC
TAGTTTGACGCATCTTCATTTGTCGTATTCGAGTTTTATAGGTCGAATCCCAGTAGAAATCTCTCGTCTTTCGGAATTACAAGTTCTTCATATCC
GGGGTTATTCGTATGAGCTTAGATTCGAACCTCACAATTTTGAACTGCTCCTTAAGAACTTGACCCGATTAAGAGAGCTCCACCTTAGCGATGTA
AACATCTCTTCCGCTATTCCTCTGAATTTCTCTTCTCATTTAACAAATCTAAGACTTCGGAACACGCAGTTATACGGGATGCTGCCCGGAAGTGT
TTTTCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545981] SGN-U582500 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346856 [Download][View] Facility Assigned ID: TUS69B19_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5