EST details — SGN-E546196

Search information 
Request: 546196Match: SGN-E546196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193906Clone name: TUS-69-G24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C101796 [cLHT-22-B11] Trace: SGN-T171023 EST: SGN-E358538 Direction: 5' Facility: TIGR
Clone: SGN-C193906 [TUS-69-G24] Trace: SGN-T347070 EST: SGN-E546195 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546196Length: 668 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E546196 [] (trimmed) GGGTTGGATGGCTTTGATTGCGGACTAACCTCAGCGTCAACACCGTAGCTGCAAATAAATGTGGCTTCATCATGGAAGCTTTAAGACATTCTGGC
CATGCAACTAGCAGCCCGTCAAGGTCTTTTAAGAGAGGAATGAGAAAAGGATCTGAAGGACTAAAGTCGATTGGTCGATCACTTGGATTTGGTGT
CTCTAAGGCAGTATTTCCTGAAGATCTGAAAGTTTCAGAGAAGAAGATTTTTGATCCTCAAGATAAATTCCTTCTCTTGTGGAATAAGCTGTTTG
TTATATCATGCATTCTGGCTGTGTCTGTTGATCCGTTGTTTTTCTACCTTCCAGTTTTCGATGACAAGTCAAATTGCCTTCAGATTGATCGAAAG
CTAGCTGTGATAGCCACAACTCTTCGTACCGTTGTTGATGCTTTCTATCTTATTCACATGGCACTTCAGTTTCGTACAGCTTATATTGCACCATC
CTCTCGAGTTTTTGGAAGGGGTGAACTAGTGATAGATCCTGGACAGATTGCTAAAAGATACTTGCGATCCTATTTTATCATCGATCTTCTTGCTG
TGGTTCCCTTGCCTCAGATTGTAGCTGGGAGATTCCTGCAGAGATCGACAGGTTCTGATGTTCTGGCTACCAACAAGCTTTGCTCTATATCATTT
TGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546196] SGN-U571285 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347071 [Download][View] Facility Assigned ID: TUS69G24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5