Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E546197

Search information 
Request: 546197Match: SGN-E546197
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193907Clone name: TUS-69-H1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546197Length: 690 bp (905 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E546197 [] (trimmed) AAGGAAATATGTAGACAAGAGACACGTAAAAGAATGTTTCTAAACTATCTCCATCAACCTACCTTTGGCAAATCCAACACACTTAAAGGGTCAGG
TATATATATATATATATTTAACTTACTTTTGCTAGAAACAAAATCCTAACACCAATATTTTGTTAACAATTTGTGCAACCTTCTTTACAGTTCAT
CATAATCAGCGGACGCGCATTGGATGTGAGATGTCTTCTTACCTCAATACTCCTCAGCAGTTCTCATCGTGACCTTTAGAAATTTGATGTGGACA
AGCTTTAACACGGAACAGAATTTGTTTTCTTGAACTGACGTTCAATTATCCTTGTGATCATGTGTTTGCTTTACAGTTTGTGAACCACCTCCTTG
CGAATCAGAGCCTTCTGCTTGTGAGACAAGATAGTCAAGTGCGACAACAATATCACTGATGATGGGGCGAAAACTGGCTTGCTCCTGGATACACA
TTGCAGTAATTGCAACTGCATGGTGCAAAGAGCGCACGGAAAACTGACCATTCAACAAAGGATCAACCATATGAACAAACTTTCTCCGGTCCTTG
AGGAAAGGACGAGACCAAACAACTAGGTTCTGCTCTCCAGCCTCTTTAGAGTTGTCATAAGCCTTTCGCCCTGTTATTAACTCCAACAGCACAAC
ACCTAAACTATAGATGTCAGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546197] SGN-U585608 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347072 [Download][View] Facility Assigned ID: TUS69H01_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5