EST details — SGN-E546345

Search information 
Request: 546345Match: SGN-E546345
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193993Clone name: TUS-69-K15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102149 [cLHT-23-M7] Trace: SGN-T170738 EST: SGN-E358178 Direction: 5' Facility: TIGR
Clone: SGN-C193993 [TUS-69-K15] Trace: SGN-T347221 EST: SGN-E546346 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546345Length: 832 bp (893 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546345 [] (trimmed) ATGAAGGAAACATACTGTTGTTAAATATTGTCTAATATGAAATATCATATATACAAGTCACAAGCATGGTCTACTGTATTCCCCTTAAAACATGC
TACTGCAATAAGTTTCTAAGTTCGGGCATAAATCTGACTCCACAGTGGAGTCACCAGAAAATTTAATTGGCAACGAAATGGTATCTTGAGTCGAC
ATAGCTCTCAACATCCCAGAGGAAAGACCCAAAAGTTACAGCCTCCAAAACAAGCCGCCTCAGCCCACCAAAACTGATCTTAATAAGTTCATCTT
TCGATGAGTCAATAGTGCCTTGAGGGGTGATAACTATCTCAGGTCTACCAAATAGTGCTTCGGTGTGTTTCTCAATCATGCCTATGGCCTCTCGA
GATCTGATGGTTGCATATCTCTGGAGGGTCTCCCCATCAAATGACATCACATAGTTTCTCAATCTTGAGGGTTTTATCCCCTGGCCAAAACCTCC
AGGACTCACACCACCTGCAGACCATGATGTCAATTCTGGGTGGGTTTGTGTTGTTGATCTGAAAGAGGTATCACTCCTATCACCACTGATATCCT
CGCCTGCCACTTGCTGGATGCTACTATCTTCATTGTCTACACCCGGAGGAAGGACTTTCATGCTCTTTTCCAGCTGAAACCTCTGGTCCACTCTC
CTGAGAAAATATCCATACATAATTGATGCTGCATAAACTTGGCCTACTCTTAATTTACTTATTTGTGCTACTGCAGAATCGTCACCCAACCGACT
TTCCAGAATGAGAGACAGGTGGTTTTTGATCATCTCGTTAGCTTCTGCTGAAATGAGATGCTCAAGCTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546345] SGN-U568023 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347220 [Download][View] Facility Assigned ID: TUS69K15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0013 Quality Trim Threshold: 20.5