EST details — SGN-E546368

Search information 
Request: 546368Match: SGN-E546368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194006Clone name: TUS-69-L4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102194 [cLHT-24-A16] Trace: SGN-T170327 EST: SGN-E358767 Direction: 5' Facility: TIGR
Clone: SGN-C194006 [TUS-69-L4] Trace: SGN-T347242 EST: SGN-E546367 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546368Length: 289 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E546368 [] (trimmed) GAAAAAAGTTGGTGAATCGTAAACGTTAACCGCTCTTCACTCTCCGCCCACTGTTCGCCGAATCCATAATGCGGAGATTCGTAGCTGATAAAGCC
AAAACTCTCATCAATAGGAGCAGGACCACCTGTTCGTCTTCTTTTCCTCCTCCTATTATTACTTCTACTTCCGTGTTGCAGCGGCTCACCTCTTC
TTCTTCTTCATCTCAATCACCTGCTGTTCTTCGTTTTTTATCCACTTCTTCTGATTCAATGTCTTCCGATTATTCATCCACTCCGGTCACTCTTG
ACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546368] SGN-U580998 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347243 [Download][View] Facility Assigned ID: TUS69L04_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5