EST details — SGN-E546393

Search information 
Request: 546393Match: SGN-E546393
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194021Clone name: TUS-69-L19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102258 [cLHT-24-E15] Trace: SGN-T170428 EST: SGN-E358868 Direction: 5' Facility: TIGR
Clone: SGN-C194021 [TUS-69-L19] Trace: SGN-T347269 EST: SGN-E546394 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546393Length: 800 bp (897 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546393 [] (trimmed) GAGAAAACAACTGACATTTCTTTTGGTTTCAATGTAAGGATCTAATGCATACAAATCGAGAAATAAGACTAAATGTGTATCATTCAGCTTCCTTA
TTACTATGAAACAAAATACTTTTGCAATTCTTACACTATTTCCTTTTCATTATACAAATGACTTGGAAGTGTTATTTAATTTCTAATATCACGTC
TAGATCTTCACTGAGAGGAATTGCATTTAACTTAGGCTTATCAGTAGCCATAAAAGGATTTGGGGACAAGTTAAGATGGCTCCCATCTCCTTCCA
GCATCTGAGTAACTTCTTTTATTGAAGGCCTATCAACGGGATGCCACTGTATGCACCAAAGTCCAACAATAGCTATTTTTCTCACGATTGTAGCA
TCTCCTTCTTCCTCTATCCGAATCTTCAATTCTTCCCCTTTCTCCAAATGTCTATATATCCATTCCAAAGAATTCACTTTGCAATGGTTATTCGT
CTTAGCATCCATATTTATCCTCCCACCAACCATTTCTAACAAGAGCATCCCAAAGCTATAAATATCAGACTTATGAGAAACTTTACCAAAGTTTC
TTGATAACACTTCTGGTGCAATGTAACCAATGGTACCCCTAGCAGCTGTCATAGTGACCGCACTTTTTTCTTTAGAACACAGTTTGGCTAGGCCA
AAATCACATATTTTGGGGTTCAAGTTGTGGTCTAAAAGGATGTTTTGTGGTTTGATATCGAAATGCAGGATTTGCTGATCACATCCCTGGTGAAG
ATACTCAATCCCTCTTGCAGTACCCAGAGCAATATGTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546393] SGN-U575324 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347268 [Download][View] Facility Assigned ID: TUS69L19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5