EST details — SGN-E546479

Search information 
Request: 546479Match: SGN-E546479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194071Clone name: TUS-69-N21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194071 [TUS-69-N21] Trace: SGN-T347355 EST: SGN-E546480 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546479Length: 779 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546479 [] (trimmed) AAAAACTTGACTCCTTCTTACATTTNTTTTTATTAACAGATATTATACCTCGTATAAAAGTTAAATTAAGGTGGAGAATAAACTACAACCTTCCA
CCATTTAAACCAACTAGAAAAAAACTTACCAAAGTCAAGTTCCAGATAGGAGCATTCGCTATACATATGTACAAGTTGATTACATAACTTATGTG
CAGTCTGATTCAGGACCAAAAAGATCGATGATGTCACCACGTACCAAAGCTGCAACCTACATGCTCTTGGGTGATAATGTGAAGTCGATCTTGCA
TGGCATCCATGGATGGATAAGGAGGAAAGCATAGGCGGAAGAAGCACGTGTGTGAAGAAGGCAAACGATCATTTGACTCTCTGGTTTTGTAGATG
TAAAGCCTAGAGGCCAAACCTCCAAAACCCTCGACGGGAAGATACTTTATTGAAGTCCAAAAGAAGAGGAGAACCTTTCTCTGCTCAGCTGTCAT
GCACCCAACAATCTTCCAAAACCAAGATATTTGAGGATCACTTTCTTTATAGCCATTATAATCAGTATGTGCTTTCCAGTCTTCCACAGAAACAG
CAGTTTCACTCCCGTGGAGCATCCAATCAAGATCTTCAAGATTTAAGCTCTGGAAAAAGGACTTCTGGAGCCTTACGGTGGTTATAATGTCAGCA
AAACCTTGAGCAAAATGAGCTACCTGCTCAGCAATGGATGTGACAAAGCGGTGCTGAATAAGAAGCTCAACATACTGCTTCCTATTTTTACTATT
CACCATGGTACTTTTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546479] SGN-U582141 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347354 [Download][View] Facility Assigned ID: TUS69N21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5