Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E546946

Search information 
Request: 546946Match: SGN-E546946
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194343Clone name: TUS-70-J5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107253 [cLPP-4-M16] Trace: SGN-T175736 EST: SGN-E363299 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546946Length: 906 bp (untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546946 [] (untrimmed)
GATTGGGACCGGGCCCCCCTCGAGTTTTTTTTTTTTTTTTTTTTTTACCATGATGATATTTGAACAAATAAAAAAGTGTTACACACGAACTATGA
ATATGTATAACCAACACTCTCTAAATGTTCATCGAAACCTGAGTATAATCATCGGATAATCCTCTTGTAGAGTAGAAATCATCATCCCCATCTCC
TCGTGCCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTA
ATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA
GTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGC
TGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTT
CGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG
CCAGCAAAAGGCCAGGGACCCGTAAAAAGCCGCGTTGCTGGCGTTTTTTCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAA
GTCAGAGGTGGCGAAACCTGACAGGACTATAAAGATACAAGGCGTTTTCCCCCTGAAGCTCCCTCGTGCGCTCTCCTGGTTCGACCCTGGCGGTT
TACCGGAAACCTGTCCGCCTTTTCTCCTTTCGGGAAGCGTGGGCGCTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T347821 [Download][View] Facility Assigned ID: TUS70J05_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.916 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5