Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E547043

Search information 
Request: 547043Match: SGN-E547043
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194399Clone name: TUS-70-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107740 [cLPP-6-J24] Trace: SGN-T175228 EST: SGN-E361456 Direction: 5' Facility: TIGR
Clone: SGN-C194399 [TUS-70-L13] Trace: SGN-T347917 EST: SGN-E547042 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547043Length: 722 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E547043 [] (trimmed) GTTTCTTCTTTATACTGATATTCAGATCTCTCTCTTTTACGATTCTTCGCATCAGCCATGGGTATCTGGGAAGCTTTTCTCAATTGGCTTCGAAG
CCTCTTCTTTAAGCAGGAAATGGAGCTTTCATTGATAGGATTGCAAAATGCAGGAAAAACATCTCTTGTAAATGTTATTGCAACTGGTGGATACA
GTGAAGACATGATACCAACTGTGGGATTTAACATGCGCAAAGTGACGAAAGGAAATGTCACTATAAAATTGTGGGACCTTGGAGGTCAACCCAGA
TTCCGCAGTATGTGGGAGAGATACTGTCGTGCTGTTTCTGCTATAGTTTATGTTGTTGATGCTGCTGATCCTGATAACCTCAGCATATCAAGTAG
TGAACTCCATGACCTGCTGAGCAAGCCATCTCTGAGTGGTATTCCATTGCTGGTGCTGGGAAACAAAATTGACAAGCCTGATTCCCTGTCCAAAC
AGGCTTTGACTGACCAGATGGGATTGAAATCAATAACTGATAGAGAAGTGTGCTGCTATATGATCTCGTGCAAGAATTCCACCAATATTGACTCA
GTCATTGATTGGCTTGTTAAGCACTCGAAATCAAAGAGCTAATGATGACTATAACTTTTTTTTTTTGTAGTGGTGCTGATTTGTATGATAAATTT
GCGAGGCTATTGGTTTTTTCTGCTGGTTTCTCCAGAGTTCTCTTGTACTGTNAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547043] SGN-U571254 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347918 [Download][View] Facility Assigned ID: TUS70L13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0102 Quality Trim Threshold: 12.5