Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E547087

Search information 
Request: 547087Match: SGN-E547087
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194425Clone name: TUS-70-M15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107922 [cLPP-7-E12] Trace: SGN-T173176 EST: SGN-E360773 Direction: 5' Facility: TIGR
Clone: SGN-C194425 [TUS-70-M15] Trace: SGN-T347963 EST: SGN-E547088 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547087Length: 605 bp (879 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547087 [] (trimmed) TCTATTACCTCTCCTGTTGGACTCACAANTCTGTGAAAAGACATCATGCTGTTTTACCATCAGCATTTTCATTTTCATTTTCACTTTCAAGGCTC
AAAGTGCTTCTATGCATAGCTATCAAACTGTGTTGATCAGCATTGTCATGATCAACCTGTTTCGTTGCCTCGGAAGTTGATAAAATACCATCTGG
ATTTTCTTGTAGCTGAAGGGCATATTCAAGATTCCATAACACATCACCCATGGACGGACGATTTATACCATTATCAGCTAAGCATTTCTCAGCTG
TTTCTGCAAATTTTTTCAAGCATTCAGGATTGATCTTGCCTTTCAAATGTGGATCAATAATATCTTCTAAATTCCCTTTCCTTTGACAAGCTAAT
GCCCAATCTGCAAGACTAACTTGTTCTTTCGGAAGATTTGAGTTAAGAGCTGGCCTTGCACACAGTACTTCAAATAGGACAACACCATATGAGTA
CACATCTGATTTTTCAGTCAATTGTTGTCTTCTGAAGTATTCAGGATCTAAATACCCGAAGCTACCCTTTACGACTGTTGAAACATGTCCTTGGT
TCATGTTTGGACCCTGTTTGGAAAGTCAAAATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547087] SGN-U595353 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347962 [Download][View] Facility Assigned ID: TUS70M15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5