EST details — SGN-E547094

Search information 
Request: 547094Match: SGN-E547094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194429Clone name: TUS-70-M19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107938 [cLPP-7-F12] Trace: SGN-T173097 EST: SGN-E360694 Direction: 5' Facility: TIGR
Clone: SGN-C194429 [TUS-70-M19] Trace: SGN-T350354 EST: SGN-E549479 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547094Length: 485 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547094 [] (trimmed) ATCTTGAAGAAGTGTACCTTTATTGGTTGCAAATAGGACACAGAACTAACAAGCTAAACAGAAGTACCGTTACTGGTTCATTTTGGTCTAGAAGA
AATCCTAAAACAATCTATTCAACTGAAAATTCATACACCATATTGTGTATGTACTTGTCACCAGGCTGAACGACAATAGAGGGAAAATTTGGTGT
GTTGATAGCATTTGGAAATCCTTGAGTCTCTAAACAGACTCCAGCATGCTTGTTATAAACAGCTCCACCTTTGCCAACAACTCCATCGACATAGT
TTGCAGTGTAAAACTGCATGCCAGGAGCATTGGTCCATAAATCAAGTACTCTGGAACTCTTAGGATCCTTGATTTTTGCAGCATGCTTCAAGCCA
TCTTTCTTGTCTCCACAGTCTAGGCACATAATTATGGTCATACCCTAAGCCAACCTGTTGGATATCACGGCCAATCTGCTTTTCAGAGGCTAAAT
CAAATGGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547094] SGN-U569711 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347969 [Download][View] Facility Assigned ID: TUS70M19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0039 Quality Trim Threshold: 20.5