EST details — SGN-E547159

Search information 
Request: 547159Match: SGN-E547159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194467Clone name: TUS-70-O9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C108250 [cLPP-8-F20] Trace: SGN-T172268 EST: SGN-E360392 Direction: 5' Facility: TIGR
Clone: SGN-C194467 [TUS-70-O9] Trace: SGN-T348035 EST: SGN-E547160 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547159Length: 786 bp (896 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547159 [] (trimmed) GAGGAAACAAATGGTAAACCAAATGAATAACTTAAGCTCTAAAACGAGTGTGTGTGCTTCATATATAAACAATAAAAAGGTCAAAAAGAAGGGAT
TCTAAATACCCAAAAAAAGCCAATGGCACACTAGGTTATGAAGGTAACGCGGCACGCGCGGCGTTTCTTCCTAAGCCAACACCCAAACCCACAGG
TACAGAATCAGTTTTGCTCTTCACATTATGACTACAATGGGCAGAATGAACATGGGCCTGGTGTGAGTTCTGGTTATTGTTGCTTATATTGATAA
CATGATGGCCATTTCCATTGATCTGATGAGAATGGCCGGTGCCGTTTTGCATACTTGAACTGTGAGGAATCTGCATCATTCCAATCCCTTCGGAC
TCAACCGATTCTTCAACACACTCAATGTCTTCATTGTAACCATTTATCAAGAAGTCTGAACAGTTCTTCTTACACCCATGATCATATGGATTACG
GAATCGACCACCTGGTCCTCTGAGGTAACTGTAACGCATCATATTGGCCATTTCATTTGTTGTAATGTTGTGTGATATCTGAGAAGCTTGTACCC
CAGTTAAGACTGCCACTCCAACGAAGAGGAAGAAGTCTGCAAATAAAAATGCTAAAGCACCAACATGGTGAGTACCGGCATGACTCAGCCAAGCC
CCAAACCATGATGGAGCTGCTGGGTCAGTCAAGACTCTTGTAAGAGTAACTGCACCAGTTAAGACCATTGCCAATACTTCCAGAACAAGAAAGAT
GAAAAAGTCCCACTTGTTTTTCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547159] SGN-U583683 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348034 [Download][View] Facility Assigned ID: TUS70O09_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5