Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E547223

Search information 
Request: 547223Match: SGN-E547223
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194504Clone name: TUS-70-P22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C108519 [cLPP-9-E22] Trace: SGN-T172498 EST: SGN-E359835 Direction: 5' Facility: TIGR
Clone: SGN-C194504 [TUS-70-P22] Trace: SGN-T350375 EST: SGN-E549500 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547223Length: 736 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E547223 [] (trimmed) GGCCTCTCGGACCTCATCATCATCGTTTGTGTCTATTCCTCTGTTTGTTCATCAATTCCCTGATTGCTTACCCACTATTCGATCTTCATTTTGAT
CTGAAACCTCAGGGTACTGGAGATTCTATGCACATATATTGATACTGTGTGGGTGCTGTTTTCATCATTGAAGGACTGATATTGCAATTTCTACT
TGAAGTTCTGTTTTCCCCCTGTTGTTATATATGGGCTGAAGTATATATTTATGGGACGTGCAGAGGATGATGAACCGCCACCAAAGCGTGTGAAG
GTATCCTCCAGAAAGGGAGATCTTCCAAAGAGTACACTTCTGACTGATCCTGCAAGTTGCTCACTGAATGACTTGATGTCTCACCCCCTGGTTCG
TCAAGGGGACGATGAGGTCGTTGGTGCAAAAGGGGTTGTTAAGAAAGTTGAATTTGTGCGAATCGTAGCAGAGGCATTATATTCTCTTGGTTATA
ACAAAGCTGGTGCACGTCTAGAAGAAGAGTCTGGGATTCCTTTGCAATCTGCTGAAGTAAAGTTATTTATGCAGCAAATCCTTGATGGTAAATGG
GATGAAAGTGTTGCCACTTTACGTAAAAATTGGTCTAATAGATGAAAAAATTGTTAAATTGGCATCATTTGAGATTATGGAAACAGAAGTTTTTT
GAACTGTTGGATGGAAAAAATGTCATGGATGCTTTAAAAACATTGAGGACTGAGCTTGGACCTCTTTGCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547223] SGN-U570622 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348098 [Download][View] Facility Assigned ID: TUS70P22_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5