Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E547608

Search information 
Request: 547608Match: SGN-E547608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194728Clone name: TUS-71-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104898 [cLPP-16-G20] Trace: SGN-T176363 EST: SGN-E363981 Direction: 5' Facility: TIGR
Clone: SGN-C194728 [TUS-71-J6] Trace: SGN-T348482 EST: SGN-E547607 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547608Length: 748 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E547608 [] (trimmed) GCACAACACACCTCCTCTTACCCAAGCTAATTCCCCCCCTATGATTAGGCAGGGAAAATCACTAAGCGAATACACGATGATTCGCCCATAATTTC
AATTTCTTCGCGCGCTTGGATGCATCATCTATCCTCTTGCAGGATGATGAGCATGAAGAGCGCGAAAACGGAGAAAAAAGGGACAATTTTGTTGC
ATAAATATGAGATTGGTAAATTGTTAGGGCAAGGTACATTTGCCAAAGTTTATTATGCAAGGAACCTAAAAACAGGACAAATTGTAGCTGTTAAG
GTAATTGACAAAGAAAAAGTGATGAAAGTTGGCTTAATTGACCAAATCAAACGTGAAATTTCTGTTATGAGATTAATTAGGCATCCAAATGTTGT
TGAACTTTATGAAGTAATGGCTAGCAAAACAAAAATTTATTTTGCAATGGAATATGTTAGAGGTGGTGAATTATTCAATAAGGTTGCTAAAGGGA
GGCTTAGGGAATCAGCAGCGCGAAAATATTTTCAACAATTAATCGCGTCTGTTGATTTCTGTCATAGTCGAGGGGTATATCATAGGGACTTGAAA
CCTGAAAATATACTCCTGGATGAAACTGGAAACCTGAAAGTTTCTGATTTTGGGTTGAGTGCTCTTTTCGATACGAAAAGACAAGATGGACTCCT
CCACACGACGTGTGGAACTCCAGCATATGTCGCGCCAGAGGTCATAAATAAGAGAGGATATGATGGCGAAAAGGCGGATATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547608] SGN-U583441 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348483 [Download][View] Facility Assigned ID: TUS71J06_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5