Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E547837

Search information 
Request: 547837Match: SGN-E547837
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194862Clone name: TUS-71-O20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106280 [cLPP-20-K15] Trace: SGN-T177501 EST: SGN-E364373 Direction: 5' Facility: TIGR
Clone: SGN-C194862 [TUS-71-O20] Trace: SGN-T348713 EST: SGN-E547838 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547837Length: 795 bp (906 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547837 [] (trimmed) CACAGAAACAGCAGACATAACTTTATTAACAGAAACACGAGGAAACATACTCCGATTGAATTTACAACTCGTGTGTACCACCAAGTAGAGTTAAT
TTGATCTTGCCAACATCACCAGTATCCACAATTTTCTTAAGTAAATGGGTAAACTGTGTATCATATGAAGTATAGATAGTCCTACACCACTAGGC
AATATTAACATGAAACAAGCTCTGCTCTTTATCAATCAAGAATGTAATCTACTAGCCTCTCTTGCCCTGAATGAAGGAAATAGAAGAAAAGAAAA
GAAACAAGGGAAAATTAAAAGTTTATGCCTTGCTATAAATGCTATTTCCTTTTTGAAACATAAACTCAAGTGGAACAGCAGCCTCTCTTCACATT
TGCGGAGGTATCACTGACATTGATGGTTGTACCCTGACCAGGAAGTGCAGTGCTATCTGCTTCCTGTGCTGCCAATGCCTTCTTGCTAATGATCT
GGTATATATCTGTCAATATAGTATGAAACGCCTTATCAACATTAAAAGCTTCCAATGCTGACGTCTCAAGAAATGACAGCCCTTCCTTCTCAGCT
AAAGCTTGACCATCCTGCTCAGAGACTGCTCTAAGATGCCTAAGGTCAGACTTGTTTCCAGCCATTATGATTACAATATTAGAGTCTGCGTGGTC
TCTCAATTCCCGTAGCCACCTCAGAACATTGTCAAAAGTTTGCCTCTTAGTTATGTCATAGACAAGGAGGGCACCAACTGCTCCTCGATAATAAG
CACTGGTAATGGCTCGGTACCTTTCTTGCCCTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547837] SGN-U569326 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348712 [Download][View] Facility Assigned ID: TUS71O20_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5