EST details — SGN-E547909

Search information 
Request: 547909Match: SGN-E547909
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188825Clone name: TUS-56-D7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48418 [cLEI-4-H9] Trace: SGN-T80388 EST: SGN-E267241 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547909Length: 629 bp (889 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E547909 [] (trimmed) TTGATTGAAAAAAAGAAGAAGAAGTATGGCTGATCAATACGAACAGAACAAGGCATCCGTTGAAGAGACTGTTGGTACCAACGTGGAAGCTACTG
ATCGTGGTTTGTTTGATTTCATTGGAAAAAAAGAAGAGGAAAAACCAAGTCATGCTCATGAAGAAGAGGCAATTTCATCTGAGTTGTCTGAAAAA
GTTAACGTAAGTGAAGAAGTGGAACCCAAGGAGGAGGAAAAGAAACTTCATCGATCAAATAGCAGCTCTAGTAGCTCCAGTGATGAGGAGGAAGA
AATTGGAGAGGATGGACAGAAGATCAAGAAGAAGAAAAAGAAGGGATTGAAGGATAAGATTAAGGAAAAAATATCTGGTGATCACAAGGAAGAAT
CGAAAGCAGAGGATACCTCAGTTCCAGTTGAGAAATACGAGGAAACAGAGGAGAAAAAAGGATTTCTAGACAAAATTAAGGAGAAATTGCCAGGT
GGCGGGCATAAGAAGACGGAGGAAGTGGCGGCGCCACCACCACCACCACCGGCTGCGGTGGAGCATGAGGCGGAGGGGAAGGAGAAGAAGGGATT
TTTGGACAAAATTAAGGAGAAATTACCAGGATACCACTTCAAGGCTGAAGATGAAAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547909] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348784 [Download][View] Facility Assigned ID: TUS56D07_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5