EST details — SGN-E548086

Search information 
Request: 548086Match: SGN-E548086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189498Clone name: TUS-57-P8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68177 [cLEN-3-H7] Trace: SGN-T88045 EST: SGN-E273449 Direction: 5' Facility: TIGR
Clone: SGN-C189498 [TUS-57-P8] Trace: SGN-T339493 EST: SGN-E538618 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548086Length: 749 bp (821 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548086 [] (trimmed) CCGTTGGAATTGAAAGTGATTTTCCCTATGTCAAGATAATTTCTGCTGAAACTATGATTGGGCTCAGCGAAAGCAGCAAATGTTCTCAGATAGTC
AAGGTATTTGAGGATGCATACAAGTCACCACTTAGTATAGTGGTCCTTGATGGGATTGAAAGACTTCTGGAATATGTTCCAATTGGCCCTCGATT
TTCAAATTTGATTTCTCAAACGCTTATGGTGCTTCTTAAACGGCTTCCTCCTAAGGGTAAAAAGATTCTTGTGATTGGAACTACTAGTGAATCCG
GTTTCTTGGAGTCAGTTGGCCTTTCTGATGCCTTCTCAGTCACATACCATGTTCCAACACTGAAGACAGAAGATGCCAAGAAGGTGTTGCAACAA
CTTGATGTCTTTGCAAGCGATGACGTTGATTCTGCTGCTGAGGCCTTAAATGATATGCCCATCAAGAAACTCTACATGGTTGTTGAAATGGCTGC
ACAGGGTGAACACGGTGGGACAGCAGAAGCCATCTATTCTGGCAAAGAAAAGATTAATATCGCACATTTCTATGATTGCCTTCAAGATATTGTTC
GATATTGAGTGTGTGGTCTCGAGTAATTTAGGTAGGAACCATGGTTTTCCTGTGAGTCCTTTACACCTTACCGTTGATTGCTGATTTGCACACAC
CCCGTTGATGGGGTTCTTCTATTCATGAGTTATTCAGAAGTTTTTATTGGCGATTCACGCAAAGATGTGTAGAGCTCATTCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548086] SGN-U569935 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348961 [Download][View] Facility Assigned ID: TUS57P08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5