EST details — SGN-E548141

Search information 
Request: 548141Match: SGN-E548141
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189694Clone name: TUS-58-H12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73338 [cLER-4-F7] Trace: SGN-T92833 EST: SGN-E278000 Direction: 5' Facility: TIGR
Clone: SGN-C189694 [TUS-58-H12] Trace: SGN-T339832 EST: SGN-E538957 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548141Length: 775 bp (930 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548141 [] (trimmed) CGCGTAAAACACGTGTACTATAAGTGATGAAGGAAAAATAGTTGAATTCAACCTACACCATACTCTCCATAATCACCAAAATTTCCGAAATTTGT
GGAGGTGTCGAATAAGATGATGTCCACAAGCCTTGGTGAATAGAGTTACGCGATAGTTCTACTAATGGGAGGTAGCAGGTACCCCGTAGAGTTAC
TCGAGATGTAAGCTAGCTCGGGCACCACAGTAATAATTAAAAAAGGATAGTGTCAACAAGTACATTAACTACTTGGCAAGGAGTAACTTTACCCT
CTTGCTAAGATCCCTCATAACATCTACAATGAGGGACTTCTTTTGTATTCTGAACTGGAGAGCCAACTCAGTAGTAGGTGAAACATTTTGCTTCA
GCAACGACTTGTCCTCCATGATTTTCGTTGGGAAGTGTCCGAGAGCAATAACACACAAAGCCACAACGGTGCGAAGAGCTGATACTTCAGTTGAT
ATTCCCAGAGGGGCTTCGACTGTCAATGATTTGAGCGTCTCTAAGTCGTGCTGCTTCACTGCTTCTTCATCGTTTGACAGGACAACTCTCAAGGC
TGCTAATAATCGGCCCTCTACTAGCTCTCCACCTCCTAGTGTCACCTTCAGATCAGAGTTTGGTCCGTCTAGATTTAAATGCGATAAAATCTGCT
GCTGCCATGGGGATGGCGAGGAGAATTTTGGGGGATGTAAACCCTGCAGCCATACTGGCAGCATCAAGAAGAGCAGCATCATATTTAAGTTCGAT
GCANTCGTAGGGGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548141] SGN-U563397 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349016 [Download][View] Facility Assigned ID: TUS58H12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5