EST details — SGN-E548149

Search information 
Request: 548149Match: SGN-E548149
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189722Clone name: TUS-58-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73561 [cLER-5-E20] Trace: SGN-T93162 EST: SGN-E279653 Direction: 5' Facility: TIGR
Clone: SGN-C189722 [TUS-58-I16] Trace: SGN-T339880 EST: SGN-E539005 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548149Length: 818 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548149 [] (trimmed) CAGCCAAGTACAGTTGGATTTTAAGTTGAAATTTTTACTTTCGATTTTGCCGGTATGTCCATGTTCTAACTTTCACATCAAATATGGGAATGTCA
TGAAAGCTGTACAAGCCATGTCAAACTAACTCTACTGTCTTCACATTCTTGTGCATTGATCTAATGACTGTTGTAACTTGTTCAATCTGATCTTC
ACTTGAACAAGACGAAAGGAGCACTTTGGCTGTTCCGCCATCTGGATAGCAACCTTCATCGATCATTTCCTCGAAGATTTCTAAGCATCTTTGGT
ACTGTTTCTTTTTGGAGTATGCTCCAAGACGGGAAGTCCATGTAACCACATCTGGCTGCAGGTTCTTAGAAGGAAGTGATTGGAAAACTTCTTCC
ATTTTTACGATAAATCCTGAACGTCCATATGCATTGATCAAGATATTGTAGGTGCTGATATCGGCTACGTATGGTCCAGCTTCTATGACAGTCAA
GAGTTCTTCCATTTTAGCAAACTGGCCAAGACGACCATACAAGTTGAGCATGCTGTTAAGAAGAAAGGTATCTAGTTTCACTCCTGATTTCTGCA
TCTGATTCACGATTTCTTCACATTTTGACACGTTACTGTTTCTAGAGTAGGCTGATATGAGTAACATGTAGGATTTCATCGTAGGAGCTATCCCC
AGCCGCGTCATCTCATCAAACACAGTTTGTGCATCTTCATGAAGACCAGCTCTTCCATAGGCATCCACCATGATATTGTATGAAGCTGTGTCTGG
TTCACAGCCCATATGCTGCATGAGAGAAAGATCTCTGCAGCACCCTGAGGGTAGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548149] SGN-U584496 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349024 [Download][View] Facility Assigned ID: TUS58I16_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5