EST details — SGN-E548214

Search information 
Request: 548214Match: SGN-E548214
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189951Clone name: TUS-59-C5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70928 [cLER-16-F20] Trace: SGN-T95739 EST: SGN-E284466 Direction: 5' Facility: TIGR
Clone: SGN-C189951 [TUS-59-C5] Trace: SGN-T340271 EST: SGN-E539396 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548214Length: 771 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548214 [] (trimmed) GTGAAGAAGAAAGAGATGTTGCATACAGAGAGTCGGTAACCTGCAAAATCTTCTTGGGGTTCACTTCAAACCTTGTTTCTTCTGGTGTTAGAGAC
ACTGTCCGCTACCTTGTTCAGCACCGGATGGTTGATGTTGTGGTTACTACAGCTGGTGGTATTGAAGAGGATCTCATAAAGTGCCTCGCACCAAC
CTACAAGGGGGACTTCTCTTTACCTGGAGCTTCTCTACGATCGAAAGGATTGAACCGTATTGGTAACTTATTGGTTCCTAATGACAACTACTGCA
AATTTGAGAATTGGATCATCCCAGTTTTTGACCAAATGTATGAGGAGCAGATTAATGAGAAGGTTCTATGGACACCATCTAAAGTCATTGCTCGT
CTGGGTAAAGAAATTAATGATGAAACCTCATACTTGTATTGGGCTTACAAGAACCGGATTCCTGTCTTCTGTCCTGGCTTGACGGATGGATCACT
TGGTGACATGCTATACTTCCATTCTTTCAAAAAGGGTGATCCAGATAATCCAGATCTTAATCCTGGTCTAGTCATAGACATTGTAGGAGATATTA
GGGCCATGAATGGTGAAGCTGTCCATGCTGGTTTGAGGAAGACAGGAATGATTATACTGGGTGGAGGGCTGCCTAAGCACCATGTTTGCAATGCC
AATATGATGCGCAATGGTGCAGATTTTGCCGTCTTCATTAACACCGCACAAGAGTTTGATGGTAGTGACTCTGGTGCCCGTCCTGATGAAGCTGT
ATCATGGGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548214] SGN-U586364 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349089 [Download][View] Facility Assigned ID: TUS59C05_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5