EST details — SGN-E548303

Search information 
Request: 548303Match: SGN-E548303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190268Clone name: TUS-59-P10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79111 [cLES-7-N13] Trace: SGN-T98932 EST: SGN-E288176 Direction: 5' Facility: TIGR
Clone: SGN-C190268 [TUS-59-P10] Trace: SGN-T340818 EST: SGN-E539943 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548303Length: 477 bp (993 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548303 [] (trimmed) AAATCAAACAGAAAGTCGACAGCACCATTGAATTCAAAACTATCAAAACAAGAGCCAATTCTATATTACAAAGCTATGAATTGTTCACTTCAGAT
CGATTTCAAAACTAGGGAGTTCATTTGTTCTAGAACTCTTGAGATGCAGAACCAATATCGCCCTTGCCTGAGCCAGCCTTTCTAGGCAACAGATT
CTGGTGAATGTTAGGCAAGACACCTCCATTAGCAATTGTAACTTGACCCAAAAGCTTGCTCAGTTCCTCATCATTTCTGACAGCCAACTGAATGT
GCCTCGGCACTATACGATTCTTCTTGTTATCCCTTGCTGCATTTCCAGCCAACTCCAACACCTCAGCAGCGGAGGTATTTCAAGGACGGCATACA
GATAAACTGGTGCACCAGCTCCAACACGTTCAGCATATTTTCCATTCTTCAGGAAACGAGCGATCCTACCGACGGGGAATTGGAGACCCGCCTTT
GA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548303] SGN-U579447 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349178 [Download][View] Facility Assigned ID: TUS59P10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5