EST details — SGN-E548326

Search information 
Request: 548326Match: SGN-E548326
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190348Clone name: TUS-60-C18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74515 [cLES-10-B23] Trace: SGN-T99612 EST: SGN-E285472 Direction: 5' Facility: TIGR
Clone: SGN-C190348 [TUS-60-C18] Trace: SGN-T340953 EST: SGN-E540078 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548326Length: 422 bp (878 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548326 [] (trimmed) GAAGTTGGAGTGGACATTGAGCTCATCACAAAGCAAAGTTGAGCTGGTTACATAGCATGGGTCGCAATTTAGGACATTTTTTTTCCAGAGTGAAG
ATGCACGATGTGGATAGTTCCTTCGGCCGCTAGTATGTTTGTTGCTGTAGGAGGGTTACCTTTTGTCTACCTTCGAGTTTATACACGAAACTAAA
CAATGTCACGACTTCTCTCTGGAGACCAGATCTTTTCAGTTTTGTGGTCGACAACAATGGTGATACAAGTATATCAAAGGGGAAGGAAAAAAAGG
ATGAATGTGATGAGAAAGGGAGTTAAAACTTATAAAAGCACTTAATATTGGCAATGAATTCGAAAGCAGTGTGTCAAAAATTAAAGAAATACAGA
AACCACTTAAGTGACAAGGATGGTATATCCTCTCTATTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548326] SGN-U573868 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349201 [Download][View] Facility Assigned ID: TUS60C18_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5