EST details — SGN-E548400

Search information 
Request: 548400Match: SGN-E548400
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190610Clone name: TUS-60-N16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76906 [cLES-19-O23] Trace: SGN-T101856 EST: SGN-E287799 Direction: 5' Facility: TIGR
Clone: SGN-C190610 [TUS-60-N16] Trace: SGN-T341403 EST: SGN-E540528 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548400Length: 722 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548400 [] (trimmed) GATCAAGTGCACATAACTAATTGTATTTGCTTTACACTTTCAATCCAAATTTCCAACTTTTCCAATCCTCAAGTAAATAGGATAAATCACTTTTT
TCTCACTCTTCCCATCTTCATTCCAAGCACTTGTAAATTTTTCAACAACATCTTCACTTAACAACTCAACACCCTTTTCTTTTGCAGTTTGATAA
GCTGACCATGACTTCAAGTATGTAAAACAAGAATCCAAGTCCATAACTTTCTCAATCTTGAACTCAAATGGTCCATTATGATCACATCCATCTAT
AGCCTCAAATGGAAAATCAATAGTTTCATACTTTTCATCGACCAATTTTCTTGGTGATTCCCAATAAGGTCCAGCATCACTTGTGTAAAATTTAT
CAAATATTGCATCTACTGAGTTGTTTATTTTAGGTGTAGTGTAACACCATGATGCTATAACACCATTTGGTTTCTTGAGTAACCATTTAACATGT
TCATAAAAAGTTGGTAGATCAAACCAATGCATTGCTTGTGCAATTGTTACTAAATCTACACTTGATTCTGATCCTATTTTTGTTTCGATTTCGGA
TTTTGACAACTTAGGAGAGGTACATATGTATTGAACATTTGGAACCTTTGCTGCAAATTCAGCTGCTTTGGACTTGTGTCTGTAGCTATCACATT
CTTGTAAAGCTTAGCTAAAGATTGAGCAGCCTGGCCACTACCAGTACCAACATCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548400] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349275 [Download][View] Facility Assigned ID: TUS60N16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5