EST details — SGN-E548494

Search information 
Request: 548494Match: SGN-E548494
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190943Clone name: TUS-61-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81947 [cLET-19-B3] Trace: SGN-T107259 EST: SGN-E296309 Direction: 5' Facility: TIGR
Clone: SGN-C190943 [TUS-61-L13] Trace: SGN-T341975 EST: SGN-E541100 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548494Length: 259 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548494 [] (trimmed) AGATGTCCTTTCTGATCCAGGGATTTCAACAAGCGGTTCAGGATTCAGATCAACGAGAAGTCACTTCTGGCAAAATCAAAGCCTAACTAATGGTA
CGCTTACTGATTCCACTCTCTCAACTGGAATTGCGGAAGAAATTGGCATTCTTCAAAGAGTAGAGCCTAATGTATCTAACAGTTAAAACAAAATG
TCTGTTAACACAAGCAAGTGTATATATGAACATCAAAATGTTTAATGAATATGAAGTTTATTCTTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548494] SGN-U574882 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349369 [Download][View] Facility Assigned ID: TUS61L13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5