Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E548702

Search information 
Request: 548702Match: SGN-E548702
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191679Clone name: TUS-63-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89642 [cLEW-18-M6] Trace: SGN-T113448 EST: SGN-E298268 Direction: 5' Facility: TIGR
Clone: SGN-C191679 [TUS-63-K5] Trace: SGN-T343239 EST: SGN-E542364 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548702Length: 774 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548702 [] (trimmed) GGTACTTTCACACAGAGCTTTTTCCTTGTACCAAAATTGGAAAATCTCAAATTGGGTGCCAATGATCTTCTCAAAGGAGTTTTACCAAAGATCCA
CCCGAGCAACACTACTCTATTGGAGTTGGATATTTCTAACACAGGAATCTCTGGTGAGCTGACTGATTCAATTGGCACCTTCAGTTCCTTGAATA
TCTTGAACCTCAAAGGATGTCGATTCTCTGGTTCCATTCCTGATTCCATTGGCAATCTTACACAAATTAGGTATTTGGATTTCAGTTATAATCAT
TTCACCGGCCATATTCCTTCCACAATCTCTCAATTGAAGCACCTCACATATCTAAGTCTTTCATCCAACTCCTTTTCAGGTGAACTTCCCGATAT
TTTTTCTAACCTCCAAGAGTTACGTTATTTATATCTTTCTAACAACAGCTTCATCGGTTCGTTTCCTTCTAAAATTGTAAGCTTGACACATCTTG
AATGCTTAGACTTGTCCTACAACTTAATGAATGGGACCATACCATCTTCGGTGTTTAGCCTCCCTTTGTTAGGTCTGTTGTGGCTCAATAATAAT
CGATTTAGTGGACTACCCGATGAGCTCAAAACAAACCCAACATTGGTACGCCTGTTTTTAAGCCATAATCAACTCAGTTGTTCTTTTCCTCAATC
ACTTTCGAATCTCACAAACTTTCTATCCTTGACCTTTTCATCGATAGCATCACTGTCGATGAGGGAAATCAAATCACTTTTCCCTAACTAAAAGT
TTTGATGGTATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548702] SGN-U574729 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349577 [Download][View] Facility Assigned ID: TUS63K05_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5