Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E548790

Search information 
Request: 548790Match: SGN-E548790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191989Clone name: TUS-64-H3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91218 [cLEW-26-G23] Trace: SGN-T114705 EST: SGN-E302873 Direction: 5' Facility: TIGR
Clone: SGN-C191989 [TUS-64-H3] Trace: SGN-T343778 EST: SGN-E542903 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548790Length: 571 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548790 [] (trimmed) AACTTGTTAATCTCTTGACTGAAATTCTCGCTGCTAAAGGACTCAGCTCGGTTTAAACTTCTCTTGGATTCTAAATGTAGAATCACATACAAGAA
TAATTACAGGAAATGAATAAGATATATGCCTACACTAAAATTATATGATCTCTATCGTGCTTCCATAATAGTAATGCTAACATCGTTCACGGAGA
CTTGAATTCTAGAGGAGCCTTTCTTGGAAGGGGTCGGTCTTGTTGTAAATGCAGGTTGTTTAGGACTTGGTAAATCATCAATTTCCCGGGTGAGC
ATAGACAAAACTGTGGAGACATTTGGCCTGTCTTCTGCATATTCTTGTACACATAATAGTCCAACATGTACACATCTATGAATCTCCTTTTTGAG
CTGTAGTTCAATTATCTTGGAGTCAACCAATTCGACAATCTTATTTTCATTCCACAACTTCCATGCCCATGCTAGAAGGCTTAATGCACCATCCT
CTTGGTAAAAGCTAGTGTTCCTCCTTCCGCTAATAATTTCCAGTAACAATACGCCAAAGCTGTAGACATCTGATTTTTCTGAGAATCTTCCTGTC
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548790] SGN-U567053 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349665 [Download][View] Facility Assigned ID: TUS64H03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0006 Quality Trim Threshold: 20.5