EST details — SGN-E548846

Search information 
Request: 548846Match: SGN-E548846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192187Clone name: TUS-64-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94588 [cLEX-4-M18] Trace: SGN-T115866 EST: SGN-E303929 Direction: 5' Facility: TIGR
Clone: SGN-C192187 [TUS-64-P9] Trace: SGN-T344118 EST: SGN-E543243 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548846Length: 654 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548846 [] (trimmed) GAGTAAATTCATACTTCATCTATGAAAATGATGTGTACAATCTCAAAGACAACAAATTCTACAGGACATAATGTACAACTTGATCTAAGCACACA
TTTGCACGATTTCAAAACGTAAAAGAAAACAAACTAAGAGCTAAACACACTATGATATCTCCAAGCAAGTTGCAATGTCCTTTATTTGGAGAAGT
AGGTTTTTGGAGATAGAAGACGACGAGGAGAAAGCATGGCTATAAATCTTGGTGAGGCAATTGCATCGATAGTGCGATTGCTTGGAACACCAAAG
TCATCTCTTGGTAGGTTAGCACCACTAAATGTGCTACATCTTGCTAACTTTCCAAACCATGACTTCTTCTTAGGGGACTTGTCATGCATACCGTT
GATCTTTTCACACAAGTATTGCTTAACTGCACGTATCCCTTGCTCCACTACCTCCGGTGGAGGAGAAACAAGGCGGTTGCCTTCAACACTTAGCT
TTTGGAGCTTCTTCAAGCATCCGATGGAATCTGGTAATTCAGTAATTTTGTTGTAACTAACATCTAGTTCGTGTAGAGAAATGAGCAAACCTACT
GAATAGGGCAACTTTGAAAAGTACTGAAAAATTTGGCTAACGTTGAGGAATTCAAGGTTGATTAAGGTTTCAAGATCATCGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548846] SGN-U566864 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349721 [Download][View] Facility Assigned ID: TUS64P09_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5